16S rRNA

Gary L. Hines

glhines@acm.org

This Web page is for those who want to make more sense of the Full Genome Sequence (FGS) results of their mitochondrial DNA (mtDNA). It concentrates on bases 1671-3229 of the mtDNA sequence, which code for the large subunit (16S) ribosomal RNA (rRNA).

After the rRNA is transcribed, it folds into a secondary structure of stems and loops, mostly following canonical (Watson-Crick, G-C and A-U) base-pairing, although there are some alternate base-pairings, such as G-U. (Note that the U base in RNA is coded as a T base in DNA. The tables below are showing the mtDNA.) The secondary structure given below is that published in Angela Burk, Emmanuel J. P. Douzery and Mark S. Springer, The Secondary Structure of Mammalian Mitochondrial 16S rRNA Molecules: Refinements Based on a Comparative Phylogenetic Approach, Journal of Mammalian Evolution, Vol. 9, No. 3, September 2002, 225-252.

Tables 1 through 33 below show the secondary structure, as given by Burk, Douzery and Springer (2002). The structure (stems and loops) and Cambridge Reference Sequence (CRS) sequence locations are given with representative sequences for several mammal species. Table 0 lists the species and GenBank numbers for the sequences:

Table 0

Species Common name GenBank No.
Homo sapiens Human J01415
Pan troglodytes Chimp AB062513
Gorilla gorilla Gorilla D38114
Pongo pygmaeus Orangutan D38115
Bos taurus Cow J01394
Loxodonta africana African elephant AF039436
Bradypus tridactylus Sloth AF069535
Mus domesticus Mouse J01420
Hydrochaeris hydrochaeris Capybara AF069533
Oryctolagus cuniculus Rabbit AJ001588
Pteropus hypomelanus Flying fox AF069537
Equus caballus Horse X79547
Ornithorhynchus anatinus Platypus X83427
Didelphis virginiana American opossum Z29573
Wallabia bicolor Swamp wallaby AF027987
Felis catus Cat U20753
Odocoileus virginianus Deer M35874
Sus scrofa Pig AJ002189

The sequences below are as given in Burk, Douzery and Springer (2002), except for chimp, gorilla, orangutan, cat, deer and pig. These were added by me, and any errors with them are entirely mine. I also am responsible for fiddling with the human secondary structure a little in Table 31 below.

The secondary structure can give you clues as to why your rRNA mutations may have occurred. For example, in Table 29 below, Stem 48 in the secondary structure forms the following shape, using the rCRS sequence:

A change from G to A at position 3010 has occurred independently in several different mtDNA haplogroups, and it is considered the founding mutation for the H1 haplogroup. To see why this change may have occurred more than once, notice that it changes the 3010-3027 base pairing from G-U to A-U:

In other words, this mutation changes the base pairing to the more favored canonical (Watson-Crick) A-U pairing.

The tables below also show whether your mutation is shared with another mammal species. For instance, 12 out of the 18 mammal species have an A-U pairing at the positions corresponding to human 3010-3027; 4 have a G-C pairing; and only human and chimp have a G-U pairing. That means people in the H1 haplogroup, and others with G3010A, have a "back mutation" at this locus that seems to work fine for most other mammal species.

I hope you can make similar discoveries about your rRNA using the tables below.

Table 1

Structure loop
rCRS position 1671
Human GCTAAACCTAGCCCCAAACCCACTCCACCTT----ACTACCAGACA---A
Chimp GCCAAACCTAGCCCCAAACCCCCTCCACCTT----ACTACCAAACA---A
Gorilla GCAAAACCTAGCCCCAAACCCACCCCACATT----ACTACCAAACA---A
Orangutan GCTAATCCTAGCCCCGAACCCAATCCACCCT----ACTACCAAAT--CAA
Cow ACTAGACCTAGCCCAAAGATA-CCCTCTCGACTAAACAACCAAGAT--AG
Elephant ACTAAATCTAGCCCTACCAAC--CCTACACT--CAATTCTCA-TAT-TAT
Sloth GCCAGACCTAGCCCTACACAACCCTTAACTCAACTACCAACATCAGCCCA
Mouse ACTAATCCTAGCCCTAGCCCTACACAAATAT---AATTATAC-TA--TTA
Capybara GCCTACTCTAGTCCAAACCCC----AATCATCACAACTACTA-CACAAGT
Rabbit GCCAACACTAGCCCTATGAAA---CTAACAC-TGAACCAGAG-TAA-TTA
Flying fox ACAAATGCTAGCCCATACAAA----TATAAACCCAACTAGCAATAC--AA
Horse ACTAAAGCTAGCCCAAACAAT-ACCTA--AT-TCAATTACCC-TTA-GTC
Platypus GCCAACTCTAGCCCAAATTAA-TCTTAATAC----ACATATA-AAC-TCT
Opossum ACTAACCACAGCCCTAAAATCATATCA-AATT--AACTAAC--TAC-TTT
Wallaby GCCAATTTAAGCCCACTCAACCATCAA--AT--CAAATATTA-CAA-TCA
Cat GCTAAAGCTAGCCCAAACATC-TACAAACACAACTAACACTAG-----AA
Deer ACTAACCCTAGCCCACAAATC-CATTTATACTAAATTATCAAG----ATA
Pig ACCAAAGCTAGCTCAACATAC-TAAACAAATACAAAAATACAC----CAA

Table 2

Structure loop 1 loop 1' loop 2 loop 2'
rCRS position 1714 1722 1724 1728 1730 1739 1747 1752
Human CCTTAGCC AA ACCA TT TACCCAAA----T AaagtaTA GGCGA TAgaaaTt
Chimp CCTTAACC AA ACCA TT TACCCAAA----T AaagtaTA GGCGA TAgaaaTt
Gorilla CTTTAATC AA ACCA TT TACCCAAA----T AaagtaTA GGCGA TAgaaaTt
Orangutan CCTTAACC AA ACCA TT CACCCAAG----C AaagtaTA GGCGA TAgaaaTt
Cow AATAAAAC AA AACA TT TAATCCCAAT-TT AaagtaTA GGAGA TAgaaaTc
Elephant ATTAAATC AA AACA TT CACTTACCA---A AaagtaTA GGAGA TAgaaaTt
Sloth AACCAACC AA ACCA TT TACACCA---ATA AaagtaTA TGCGA TAgaaaTt
Mouse TATAAATC AA AACA TT TATCCTAC---TA AaagtaTT GGAGA AAgaaaTt
Capybara CGTAAAAC AA AACA TT TATCCAA-----A aaagtaTA GGAGA TAgaacat
Rabbit GCTAAACT AA ACCA TT CACCCCATAT-TA AaagtaTA GGAGA TAgaaaTt
Flying fox AATAAAAC AA AACA TT TACCCTG---ACT AaagtaTA GGAGA TAgaaaTt
Horse ACTTAACT AA AACA TT CACCAAACC-ATT AaagtaTA GGAGA TAgaaaTt
PlatypusAATAAACT AA AACA TT TTAACGCTAACCC CtagtaTA GGAGA TAgaaaaG
Opossum TTCAATTT AA ACCA TT ---TTAATT-ATC CtagtaTA GGTGA TAgaaaaG
Wallaby CTTAATCT AA ATCA TT TATCCCG----TC TaagtaTA GGTGA TAgaaaaG
Cat AATAAAAC AA AACA TT TAGTCACCTTATA AaagtaTA GGAGA TAgaaaTt
Deer CTACAAAT AA AACA TT TATCCACTGT-TA AaagtaTA GGAGA TAgaaaTt
Pig AATAAAAT AA AACA TT CACCTAACA--TT AaagtaTA GGAGA TAgaaaTt

Table 3

Structure loop 3 loop 3' loop
rCRS position 1760 1785 1787 1791 1793
Human GAAAC---CTGGCGCAATAGAT-ATAGTA CC GCAA GG GAAAGATGAAAAA
Chimp GTAAA---CCGGCGCAATAGAC-ATAGTA CC GCAA GG GAAAGATGAAAAA
Gorilla GTAAA---TCGGCGCAATAGAT-ATAGTA CC GCAA GG GAAAGATGAAAAA
Orangutan ATAAT---CCGGCGCAATAGAT-GCAGTA CC GCAA GG GAAAGATGAAAAA
Cow TAAGTA---CGGCGCTATAGAG-AAAGTA CC GCAA GG GAACGATGAAAGA
Elephant TCACT---AAGGCGCAATAGAG-ATAGTA CC GCAA GG GAATGATGAAAGA
Sloth ATTAA---CAGGCGCCATAGAG-ATAGTA CC GCAA GG GAAAGATGAAAGA
Mouse CGTACATCTAGGAGCTATAGAA-CTAGTA CC GCAA GG GAAAGATGAAAGA
Capybara TTTTA----AGGCACTATAGAG-ATAGTA CC GCAA GG GAAAGATGAAAGA
Rabbit TATATC--CAGGCGCTATAGAG-AAAGTA CC GTAA GG GAAAGATGAAAGA
Flying fox TTAAT---CTGGCGCTATAGAG-AAAGTA CC GCAA GG GAACGGTGAAAGA
Horse TTAAC---TTGGCGCTATAGAG-AAAGTA CC GTAA GG GAACGATGAAAGA
PlatypusGAAAT----TGGAGCCTTAGAC-ATAGTA CT GTGA AG GAAAAATGAAAGA
Opossum ATATAA--TAGGAGCTATAGTTTATAGTA CC GCAA GG GAAAAATGAAAGA
Wallaby ACTAATT-CAGGCGCAATAACG-CAAGTA CC GCAA GG GAATCATGAAAGA
Cat TAAC----TTGGCGCTATAGAG-AAAGTA CC GCAA GG GAAAGATGAAAGA
Deer TTAGAT--ATGGCGCTATAGAG-AAAGTA CC GTAA GG GAACGATGAAAGA
Pig TTTATC--CTGACGCTATAGAG-ATAGTA CC GTAA GG -AAAGATGAAAGA

Table 4

Structure loop 4 loop 4' loop
rCRS position 1806 1829 1832 1839 1842
Human TTA--TAACCAAGCATAATATAGCA AGG ACTAACC CCT ATACCTTCTGCA
Chimp TTA--TACCCAAGCATAATACAGCA AGG ACTAACC CCT GTACCTTTTGCA
Gorilla ATA--TAACCAAGCACGACACAGCA AGG ACTAACC CCT GTACCTTCTGCA
Orangutan ACG--AAACCAAGCACAACACAGCA AGG ATTAACC CCT GTACCTTTCGCA
Cow AAAAAACTAAAAGTATAAAAAAGCA AAG ATTACCC CTT GTACCTTTTGCA
Elephant TAG--TTTAATAGTAAAAAATAGCA AGG ATTAACC CCT TTACCTTTTGCA
Sloth ACA--ACTAACAGCACAAAACAGCA AAG ACCAACC CTT TTACCTTTTGCA
Mouse CTA--ATTAAAAGTAAGAACAAGCA AAG ATTAAAC CTT GTACCTTTTGCA
Capybara TAAA-TTACACAGTAAAAAAAAGCA TAG ATTACCC CTA CTACCTTTTGTA
Rabbit TTA--GTTAATAGCACAAAAAAGCA GAG ATTACTT CTC TTACCTTTTGCA
Flying fox CAA--ATTAAAAGTAAAAAACAGCA AAG CTTACCC CTT GTACCTTTTGCA
Horse TGC--ATTAAAAGTACTAAACAGCA AAG CTTACCC CTT TTACCTTTTGCA
PlatypusTTA--GCTTAAAGCACAAAAAAGCC AGG ATTTAAC CCT GTACCTTTTGCA
Opossum TAA---ATTATAGTAATTAAAAGCA AAG ATTAACT CTT GTACCTTTTGCA
Wallaby CCA--ATTCCTAGCACTAAAAAGCA AAG ATTAGAC CTT CTACCTTTTGCA
Cat TAA-AATTAAAAGCACCACACAGCA AAG ATTACCC CTT GTACCTTTTGCA
Deer AAAAA--TTAAAGTACAAAAAAGCA AAG ATTACCC CTT GTACCTTTTGCA
Pig ATAA-AATAAAAGTAAAAAAAAGCA AAG ATTACCC CTT CTACCTTTTGCA

Table 5

Structure loop 5 loop 6 loop 7 loop 7' loop 6' loop
rCRS position 1854 1860 1866 1875 1879 1880 1885 1889 1895 1896 1900
Human TAATGA ATTAAC TAGAAA-TAA CTTt G CaaGG AGAG CCaaaG C tAAG ACC
Chimp TAATGA ATTAAC TAGAAA-TAA CTTt G CaaaG AGAA CcaaaG C tAAG ACC
Gorilla TAATGA ATTAAC TAGAAA-TAA CTTt G CaaaG AGAA CcgaaG C tAAG ACC
Orangutan TAATGA ATTAAC TAGAAA-CAA CTTt G CaaGG AGAA CCgaaG C cAAG ACC
Cow TAATGA ATTAAC TAGTATAAGA CTTA A CaaAA TGAA TTttaG C TAAG CAG
Elephant TAATGA ATTAAC TAGAA--AAA TCTG A CaaAG AGAA CTataG C CAGA AAC
Sloth TAATGA ACTAAC CAGAAA-AAC cTTG A CaaAG AGCC CTtcaG C CAAa AAC
Mouse TAATGA ACTAAC TAGAAA-ACT TCTA A CtaAA AGAA TTacaG C TAGA AAC
Capybara TAATGA ATTAAC TAGAAC-CAA cTTG A CaaAG TGAA CTgaaG C CAAc CAC
Rabbit TAATGA ATTAGC TAGAAA-ATC CTTA G CaaAA AGAA TTttaG T TAAG AAC
Flying fox TAATGA tTTAAC TAGAG--TAA cTCG A CgaAG AGAA CTaaaG C CGAa TAG
Horse TAATGA tTTAAC TAGAAT-AAA CTTA G CaaAG AGAA CTtaaG C TAAG CAC
Platypus TAATGG TTTAGC TAGAA--AAC tTAT A TacAA AGAA TTttaA T ATAa AAT
Opossum TAATGA TTTAGC CAGTC--AAC aCGG A CaaAA AGAA TT-atG C CCGa CAT
Wallaby TAATGA TTTAGC CAGTT--AAA tCGG A CaaAA AGAA TT-acG C CCGc CTC
Cat TAATGA GTTAGC TAGAA--CAA CCTA A CaaAG AGAA CTtcaG C TAGG CCC
Deer TAATGA GTTAAC TAGTA-AAAA CTTA A CaaAA TGAA TTtcaG C TAAG TAC
Pig TAATGG tTTAAC CAGAA-AAAA TCTA A CaaAG AGAA CTttaG C TAGA TAC

Table 6

Structure 8 loop 9 loop 10 loop 10' loop 11
rCRS position 1903 1916 1919 1931 1932 1935 1940 1943 1946
Human CCcgaaaCCAGaC GAG CTACCTAAGAAC A GCT ---AAAAG AGC ACA CCCGTcTAT
Chimp CCcgaaaCCAGaC GAG CTACCTAAGAAC A GCT ---AAAAG AGC ACA CCCGTcTAT
Gorilla CCcgaaaCCAGaC GAG CTACCTAAGAAC A GCT ---AAAAG AGC ACA CCCGTcTAT
Orangutan CCcgaaaCCAGaC GAG CTACCCATAAAC A GCT ---AAAAG AGC GCA CCCGTcTAT
Cow CCcgaaaCCAGaC GAG CTACTcACAAAC A GTT -TACCAAG AAC TAA CTCATcTAT
Elephant CCcgaaaTCAGaC GAG CTATCTGAtAGT A ATC --CCCA-G GAT CAA TTCATcTAT
Sloth CCcgaatCCAGaC GAG CTACCcGCGGAC A GCa ---CAAAG aGC CAA TTCATcTAT
Mouse CCcgaaaCCAAaC GAG CTACCTAAAAAC A ATT --TTAT-G AAT CAA CTCGTcTAT
Capybara CCcgaaaCCAAaC GAG CTACTTCCAAAC A GCT --AACA-G AGC AAA CTCGTcTAT
Rabbit CCcgaaaCCAGaC GAG CTATTTATGAGC A GTT --GAAA-G AAC GAA CCCGTcTAT
Flying fox CCcgaaaCCAGaC GAG CTACCTAAGAGC A GCA ----AAAG AGC CAA CTCGTcTAT
Horse CCcgaaaCCAGaC GAG CTACCTATGAAC A GTT ACAAAT-G AAC CAA CTCATcTAT
Platypus CCcgaaaCTAGaT GAG CTACTATCGAGC A ATT -TATTA-G AAT CAA CCCGTcTAT
Opossum CCcgaaaTTAAGT GAG CTACTATAAGAC A GTT ACTAAT-G AAC CAA CTCATcTAT
Wallaby CCcgaaaTCAAGT GAG CTACTATAAAAC A GTT -AATTT-G AAC CAA CTCGTcTAT
Cat CCcgaaaCCAGaC GAG CTACCCATGAAC A ATC TATTACAG GAT GAA CTCGTcTAT
Deer CCcgaaaCCAGaC GAG CTACTTATGAAC A ATT -TATCGAG AAT CAA CTCATcTAT
Pig CCcgaaaCCAGaC GAG CTACCCATGAGC A GTT --TAAAAG AAC CAA CTCATcTAT

Table 7

Structure loop 11' loop 9' loop 12 loop 12' loop
rCRS position 1955 1963 1971 1973 1986 1987 1990 1995 1998
Human GTAGCAAA ATAGTGGG AA GaTTTATAGGTAG A GGC GACAA ACC TA
Chimp GTAGCAAA ATAGTGGG AA GaTTTATAGGTAG A GGC GACAA ACC TA
Gorilla GTAGCAAA ATAGTGGG AA GaTTCCTAGGTAG A GGC GACAA ACC TA
Orangutan GTGGCAAA ATAGTGGG AA GaTTTATGGGATG A GGC GACAA ACC AT
Cow GTGGCAAA ATAGTGAG AA GaTTTGTaAGTAG A GGT GACAT GCC TA
Elephant GTGGCAAA ATAGTGAA GA AaCTtACAGATAG A GGT GAAAT ACC AA
Sloth GTTGCAAA ATAGTGAA AA GaTCCTCaGGTAG A GGT GAAAA GCC TA
Mouse GTGGCAAA ATAGTGAG AA GaTTTTTAGGTAG A GGT GAAAA GCC TA
Capybara GTAGCAAA ATAGTGAG AA GaTTTCGAAGTAG A GGT GAAAA GCC AA
Rabbit GTGGCAAA ATGGTGGG AA GaCTTGTAAATAG A GGT GAAAA GCC AA
Flying fox GTAGCAAA ATAGTGAG AA GaCTTTTAGGTAG T GGT GAAAA GCC TA
Horse GTCGCAAA ATAGTGAG AA GaTTCGTAGGTAG A GGT GAAAA GCC CA
Platypus GTTGCAAA ATAGTGGG AT GaCTTTATAGTAG A GGT GAAAA ATC AA
Opossum GTAGCAAA ATAGTGAG AA GaTTTTATAGTAG A aGT GAAAA ACc TA
Wallaby GTAGCAAA ATAGTGAG AA GaTTTTATAGTAG A GGT GAAAA GCC TA
Cat GTTGCAAA ATAGTGAG AA GaTTTGTGGGTAG A GGT GAAAA GCC TA
Deer GTGGCAAA ATAGTGAG AA GaTTCATAAGTAG A GGT GAAAC GCC TA
Pig GTGGCAAA ATAGTGAG AA GaCTTGTAGGTAG A GGT GAAAA GCC TA

Table 8

Structure loop 8' loop 13 loop 14 loop 14' loop
rCRS position 2000 2004 2020 2022 2028 2032 2036 2040 2044
Human -CCGA GcCTGGtgatagctGG TT GTCCAA GA-TA GAAT CTTA GTTC AAC
Chimp -CCGA GcCTGGtgatagctGG TT GTCCAA GA-TA GAAT CTTA GTTC AAC
Gorilla -CCGA GcCTGGtgatagctGG TT GTCCAA GA-CA GAAT CTTA GTTC AAC
Orangutan -CCGA GcCTGGtgatagctGG TT GTCCAA GA-CA GAAT CTTA GTTC AAC
Cow -ACGA GcCTGGtgatagctGG TT GTCCAG AAAAT GAAT CTAA GTTC AGC
Elephant -TCGA GcCTGAtgatagctGG TT GTCCAG AAATA GAAT TTTA GTTC TAC
Sloth ACCGA GcCTGGcgatagctGG TT GTCCAG GAACT GAAC CTAA GTTC AAC
Mouse -ACGA GcTTGGtgatagctGG TT ACCCAA AAAAT GAAT TTAA GTTC AAT
Capybara -CCGA GtTTGGtgataactGG TT ATCCAA AT-AA GAAT TT-A GTTC AGC
Rabbit -CCGA GcCTGGtgatagctGG TT GTCCAG AA-TA GAAT TTTA GTTC AAC
Flying fox -CCGA GcCTGGtgatagctGG TT GTCCAG AA-TA GAAT TTTA GTTC GAC
Horse -ACGA GcCTGGtgatagctGG TT GTCCAG AAACA GAAT TTCA GTTC AAA
Platypus -CCGG AcCTAGtgatagctGG TT AGCCAA AAAAC GAAT TTAA GTTC AAC
Opossum -TCGA ACTTAAtgatagctGG TT ATCCAA AA-AA GAAT TTAA GTTC AAC
Wallaby -CCGA ACTTGAtgatagctGG TT GTCCAA AATAT GAAT TTTA GTTC AAC
Cat -ACGA GcCTGGtgatagctGG TT GCCCAG AA-CA GAAT CTTA GTTC AAC
Deer -ACGA GcCTGGtgatagctGG TT GTCCAG GAAAT GAAT ATTA GTTC AGC
Pig -ACGA GcCTGGtgatagctGG TT GTCCGA GA-AA GAAT TTTA GTTC AAC

Table 9

Structure 15 loop 15'
rCRS position 2047 2058 2082
Human tTTAAATT-TGC CCACAG-----AACCCTCTA-AATCCCCTT GTAAATTTAAc
Chimp tTTAAATT-TAC CCACAG-----AACCCTCTA-AATCCCCTT GTAAATTTAAc
Gorilla tTTAAATT-TAC CCACAG-----AACCCTCCA-AATCCTCTT GTAAATTTAAc
Orangutan tTTAAATT-TAC TTACAG-----AGTCCCT---AATCCCCTC GTAAATTTAAc
Cow TTTAAAGA-TAC CAAAAA-----TTCAAATA--AACCCCACT GTAGCTTTAAA
Elephant CTAAAACT-TAC CACAAA-----AACAAAAT--AATTCCAAT GTAAGTTTTAG
Sloth TTAAAATT-TGc CCAAAGAACATAACATCA---AATCTCAAC aCAAATTTTAA
Mouse TTTAAACT-TGC TAAAAA-----AACAACAA--AATCAAAAA GTAAGTTTAGA
Capybara TTTAAGTT-TTC CCAAAAC-----ACCAGA---AAGTCTAAT GAAAACTTAAA
Rabbit TTTAAATT-TTC CTAAAGG-----ACATAA---AACCCTAAT GAAAATTTAAA
Flying fox TTTAAGTCaTGC CTAAAA------AAACCAC--AATTCAAAT GCAGACTTAAA
Horse TTTAAATT-TAC CTAAAA-----ACTACTC---AATTCTAAT GTAAATTTAAA
Platypus aATAAGTT-TAT TTCCTG------ATATACT--ATATTAACC ATAAACTTATa
Opossum TTTAAGTCcTAT TACAA------TGCCTATTCAAAGCACACA ATAaGCTTAAA
Wallaby TTTAAATT-TAA TTAAAT-----TACCAAC---AAACCTAAC TTAAATTTAAA
Cat TTTAAACT-TAC CTCAAA-----AACCTAA---AATTCCAAT GTAAGTTTAAA
Deer TTTAAAAAATAC CAATAA-----TATAAAC---AAATATACT GTATTTTTAAA
Pig CTTAAAAA-TAC CCCAAA-----AACCCTA---AATTCCAAT GTAtTTTTAAG

Table 10

Structure loop 16 loop 16' loop 17 loop 17' loop
rCRS position 2093 2098 2108 2114 2124 2128 2130 2136 2138
Human TGTTA GTCCAAAGAG GAACAG CTCTTTGGAC ACTA GG AAAAAA CC TTGT
Chimp TGTTA GTCcAAAGAG GAACAG CTCTTTaGAC ACTA GG AAAAAA CC TTGT
Gorilla TGTTA GTCCAAAGAG GAACAG CTCTTTGGAC ACTA GG AAAAAA CC TTGT
Orangutan TGCTA GTCTAAAGAG GAACAG CTCTTTAGAC ACTA GG AAAAAA CC TTAA
Cow AGTTA gTCTAAAAaG GTACAG CcTTTTAGAa --AC GG ATACAA CC TTGA
Elephant AGATA tTCAAAAGGG GTACAG CTCTTTTGAc -CAA GG ACACAA CC TTGA
Sloth ATATA ATCAaCAGAG GTACAG CTCTGcTGAT --AA GG GACAAA CC CCAC
Mouse TTATA gCCAaAAGAG GGACAG CTCTTcTGGa --AC GG AAAAAA CC TTTA
Capybara ACTTA aTTTAAAGAG GGACAG CTCTTTAAAa -CAA GG GAACAA CC TTCA
Rabbit TGTTA cTCTAAAGAG GGACAG CTCTTTAGAt -ATA GG ATACAG CC TTTT
Flying fox ATGTA aTCTAAGAGG GTACAG CCTCTTAGAa -GCA GG ATACAA CC TTGA
Horse TTATA GTCTAAAAAG GTACAG CTTTTTAGAT -ACA GG TTACAA CC TTCA
Platypus AGTTA TTCATAAGaG GGTCAG CcCTTATGAA -TAA GG AAACAA CC TCTA
Opossum AGTTA GTCAAAGAAG GGACAA CTTCTTTGAC -CAA GT ATACAA AC TACA
Wallaby AGCTA ATCAAAAGGG GGACAA CTCTTTTGAT -CAT GT AAACAA AC TTTA
Cat ATATA GTCTAAAAAG GTACAG CTTTTTAGAC -CTA GG ATACAG CC TTTA
Deer AGTTA gTCTAAAAaG GAACAG CcTTTTAGAa --AC GG ATACAA CC TTAA
Pig AGATA gTCTAAAAAG GTACAG CTTTATAGAa --AC GG ATACAA CC TTGA

Table 11

Structure 18 loop 19 loop
rCRS position 2142 2155 2168 2176
Human aGAGaGAGtaaaa AATTTAACACC-------CA TaGtaGGC CTAAAAGC
Chimp aAAGaGAGtaaaa AATTTAACACC-------CA TaGtaGGC CTAAAAGC
Gorilla aAaGtGAGtaaaa AATTTAATACC-------CA TaGtaGGC CTAAAAGC
Orangutan aAAGaGAGtaaaa AACACAGCACC-------CA TaGtgGGC CCAAAAGC
Cow CTAGaGAGtaaaa TTTAACACTAC-------CA TaGtaGGC CTAAAAGC
Elephant TTAGcGAGtaa-a TTCACCATTAAT----TTCA TaGttGGC TTAGAAGC
Sloth cTAGaGAGtaacc ACCCCCCCCCCC----CCCA TaGtaGaC CTAAAAGC
Mouse aTAGtGAAtaatt AACAAAACAGCTTTTAACCA TtGtaGGC CTAAAAGC
Capybara aCAGtGGGtaagt AAATCAAAATA------CCA TaGttGGC CTAAAAGC
Rabbit ATAAaGAGtaagt TATTTTTCAAT------CCA TaGttGGC TTAAAAGC
Flying fox ctaGaGagtaagc ACCACAAAAATT------CA TaGttGGC CTAAAAGC
Horse TTAGaGAGtaa-g AACAAGATAAA-----CCCA TaGttGGC TTAAAAGC
Platypus aTAGaGGGaaaTT TATTCTTATTT------ACA TaGtaGGC CTAAAAGC
Opossum TTAGaGGGtaaTA ATTAATAATCC------ACA TcGttGGC TTAAAAGC
Wallaby TTAGaGGAtaaTG AATACCAAAAA------ACA TtGtaGGC CCAAAAGC
Cat TTAGaGAGtaagc ATAAATATAAA------CCA TaGttGGC CTAAAAGC
Deer cTAGaGAGtaaaa CCTGATAATAC-------CA TaGtaGGC CCAAAAGC
Pig cTAGaGAGtaaat CTTAATACTAC-------CA TaGtaGGC CTAAAAGC

Table 12

Structure loop 19' loop 20 loop 20' loop
rCRS position 2184 2185 2193 2197 2203 2209 2213
Human A GCCacCaA TTAA GaaaGC GTTCAA GCtC AACACCCACTACCT---AAAA
Chimp A GCCacCaA TTAA GaaaGC GTTCAA GCtC AACACCCACAACCT---TAAA
Gorilla A GCCacCaA TTAA GaaaGC GTTCAA GCtC AACACTATCACCC---AAAAT
Orangutan A GCCatCaA TTAA GaaaGC GTTCAA GCtC GACACCCAAACACC---AAAA
Cow A GCCatCaA TTAA GaaaGC GTTAAA GCtC AACAACAAAAATT---AAATA
Elephant A GCCatCaA TTAA GaaaGC GTTAAA GCtC AACAACCAACCAAACTAAAAA
Sloth A GcCacCaA CAAA GaaaGC GTTCAA GCtC AACTAGCAATAAC--TCCAAA
Mouse A GCCacCaA TAAA GaaaGC GTTCAA GCtC AACATAAAATTTC---A-ATT
Capybara A GCCatCaA TTAA GaaaGC GTTCAA GCtC AACAATCCGCCAAA-CCCTAG
Rabbit A GCCatCaA TTAA GaaaGC GTTAAA GCtC AACAACTAAAAAC--CAACTT
Flying fox A GCCacCaA TTGA GaaaGC GTTCAA GCtC AACAACCAACCCAG--ATTCT
Horse A GCCatCaA TTAA GaaaGC GTTCAA GCtC AACGAC--ACATC--TATCTT
Platypus A GCCatCaA TTAA AaaaGC GTTAAA GCtT AAACTTCATTCTT----TCTT
Opossum A GCCatCaA CTAA GaaaGC GTTAAA GCtC AAACTCACATTCC---AATTT
Wallaby A GCCacCaA TTAA GaaaGC GTTAAA GCtC AAATAT--ATCAATAAACCTT
Cat A GCCatCaA TTAA GaaaGC GTTCAA GCtC AACAATCAAAGCAT----CTT
Deer A GCCacCaA TTAA GaaaGC GTTAAA GCtC AACAATAAAACTAT----CTT
Pig A GCCatCaA TTGA GaaaGC GTTAAA GCtC AACAAATTCACC----AACAT

Table 13

Structure loop 18' loop 13' loop
rCRS position 2231 2247 2259 2266 2272
Human AATCCCAAACATATA----A ctgaaCTCCTCa CACC--CAA TTGGAC CAA
Chimp AATCCCAAACATACA----A ccgaaCTCCTTa CACC--CAA TTGGAC CAA
Gorilla AATCCCAAACACACA----A ctgaaCTCCcTa CACC--CAA TTGGAC CAA
Orangutan AATACCAAACATAAG----A ctgaaCTCCTTa CTCC--CAA TTGGAC CAA
Cow GATTCCAACAACAAATG--- attaaCTCCTAG CCCC-AATA CTGGAC TAA
Elephant GATTCCAAAATTAATT---A atgatCTCCTAA ACAT-AATA CTGGAC TAA
Sloth AATACCAAAAACCAC----A cccaaCTCCTAa AACC--CCA CTGGAC CAA
Mouse AATTCCATAATTTAC----A ccaacTTCCTAa ACTT-AAAA TTGGGT TAA
Capybara AATCTCTTCAAAACTA---A acaaaCCCCTGa CCAA--CAA TTGGAT TAA
Rabbit AATAAGAATATTTTAA---A acgaaCTCTTAT AAACCCTAA CTGGAC TAA
Flying fox AATTCAAAAGATTAT----A cgcgaacCCcta GCCCGACCA CTGGAC CAC
Horse AATCCCAACAATCAACCCAA actaaCTCCTAA TCTC-A-TA CTGGAC TAT
Platypus AATCCCTTAACTTCT----T AActaCCCCTAa AAT--AATA TTGGCT TAA
Opossum AATACCATAAAAAAA----C TAaaaCCCCTAA AAT--ACTA TTGGAT GAT
Wallaby AATCCCAAAAATAAC---AT CAaaaTCCCTAA CACAGACTA TTGGAC GAT
Cat AATGTCAAAAATAATGC--A accaaCTCCTAA CCT--AAAA CTGGGC TAA
Deer AATCCCAATAACAAAT---A atcaaCTCCTAg CCTT-AATA CTGGAC TAA
Pig AATCCCAAAAACTAAT---A acaaaCTCCTAg CCC--AATA cCGGAC TAA

Table 14

Structure 21 loop 21' loop 5' A loop 22 loop
rCRS position 2275 2280 2286 2291 2300 2306 2307 2313 2315
Human TCTAT CACCC-T ATAGA AGAACTAAT GTTAGT A TAAGTA- AC ATGAAAAC
Chimp TCTAT TTCCC-C ATAGA AGAACTAAT GTTAGT A TAAGTA- AC ATGAAAAC
Gorilla TCTAT TACCC-T ATAGA AGAGCTAAT GTTAGT A TAAGTA- AC ATGAAACC
Orangutan TCTAT TGCCC-T ATAGA AGAAACAAT GTTAGT A TAAGTA- AC GTGAAAAC
Cow TCTAT TA-TAGA ATAGA AGCAATAAT GTTAAT A TGAGTA- AC AAGAAAAA
Elephant TCTAT A--TA-A ATAGA AGAAATAAT GTTAGT A TAAGTA- AT AAGAAGTA
Sloth TCTAT A----AT ATAGA AGAGACAAT GTTAGT A TAAGTA- AT AAGAATAA
Mouse TCTAT AACTT-T ATAGA TGCAACACT GTTAGT A TGAGTA- AC AAGAATTC
Capybara TCTAT AAACA-C ATAGA AGAAATAAT GTTAAT A TTAGTA- AC AAGAAATA
Rabbit TCTAT AAATC-T ATAGA AGAAATAAT GCTAAT A TAAGTA- AC AAGAATAC
Flying fox TCTAT CATAA-A ATAGA GGAAATACT GTTAAt A TGAGTA- AC AAGAACTA
Horse TCTAT CAACA-C ATAGA AGCAATAAT GTTAAt A TGAGTA- AC AAGAATTA
Platypus TCTAT GTCCC-C ATAGA AGAAATAAT GCTAAA A TAAGTAA AC CAGAATTT
Opossum TCTAT GATAT-T ATAGA ATACATAAT GCTAAA A TTAGTA- AT AAGAACCC
Wallaby TCTAT AATTT-T ATAGA AGACATAAT GCTAAA A TAAGTA- AC AAGAAACA
Cat TCTAT T-TAATA ATAGA AGCAATAAT GCTAAT A TGAGTA- AC AAGAAATA
Deer TCTAT AAA---A ATAGA AGCAATAAT GTTAAT A TGAGTA- AC AAGAAGTA
Pig TCTAT TGAAA-C ATAGA AGCAATAAT GTTAAt A TGAGTA- AC AAGAAGCC

Table 15

Structure loop 23 loop 24 loop B loop 25 loop 25'
rCRS position 2323 2324 2328 2333 2337 2343 2344 2345 2356 2360
Human A-- TTCT CCTCC GCAT AAGCCT G C GTCAGatta--aA ACA-C TgaaCTGAC
Chimp A-- TTCT CCTCC GCAT AAGCCT A C GTCAGacca--aA ATA-T TaaaCTGAC
Gorilla A-- TTCT CCTCC GCAT AAGCCT A C ATCAGacca--aA ATA-T TaaaCTGAC
Orangutan A-- TTCT CCTCT GCAT AAGCCT A C GTCAGacca--aA ACA-T CacaCTGGC
Cow TT- TTCT CC-TT GCAT AAGTCT A A GTCAGtgc--cTG ATAA- TActCTGAC
Elephant T-- TTCT CC-CT GCAT AAGCTT A T ATCAGgtc---GG ATG-C CC-gCTGAT
Sloth C-- TTCt CC-AC GCAc TAGCTT A T ATCAGaa---cGG ACCTA CC-aCTGAT
Mouse CAA TTCT CC-AG ACAT ACGCGT A T AACAAct---cGG ATA-A CC-aTTGTT
Capybara T-- TTCT CC-CT GCAC AAGCTT A A ATCAAc---caTT -C--- AA--TTGAT
Rabbit TA- TTCT CC-TT GCAC AAGCTT A T ATCAGat---cGG ATG-C CC-aCTGAT
Flying fox GT- TTCT CC-CT GCAC AAGCTT A T ATCAGaa---cGG ATGAC CC-aCTGAT
Horse T-- TTCT CC-TT GCAT AAGCTT A T ATCAGaa---cGA ATA-C TC-aCTGAT
Platypus A-- TTCT CC-AT GCAC TAGCTT A A ATTAGaa---cGG AGCAT CC-aCTAAT
Opossum CG- TTCT CC-TC GCAC AAGCCT A A GTTAGaataacGG ATATC CC-aCTAAT
Wallaby T-- TTCT CC-TA GCAC AAGCCT A A aTTAGcaa--cGG AATAC CC-aCTAAc
Cat T-- TTCT CC-CT GCAT AAGCTT A T ATCAGaa---cGG ATAA- CC-aCTGAT
Deer TC- TTCT CC-CC GCAC GAGTTT A A GTCAGtac--cTG ATAA- TAttCTGAC
Pig T-- TTCT CC-TC GCAC ACGCTT A C ATCAGtaa--cTA ATAA- TAtaCTGAT

Table 16

Structure loop 26 loop
rCRS position 2369 2375 2378
Human AATTAA- CAG CCCAATATCTACAATCAA---CCAACAAGTCATTAT---
Chimp AATTAA- CAG CCTAATATCTACAATCAA---CCAACAAGCCATTAT---
Gorilla AATTAA- CAA CTCAATATCTACAACTAA---CCAACAAGCTATTAT---
Orangutan AATTAA- CAG TCCAATATGCATAATTAA---CAAATAAACTACTAT---
Cow CACTAA- CAG TC-AATAAAAATAATCCA--ACAATAAACAATTTAT---
Elephant AGTTAA- CAA CCGAATAATTAGATACAA---AAATAGAACCTTTAT---
Sloth AGTTAA- CAG CCAGACTTCCACACTCCCC--CAAATATCCCCAAGTC--
Mouse AGTTAAT CAG AC-TATAGGCAATAATCAC-ACTATAAATAATCCACCTA
Capybara TATTAA- CAA CCTAATAAGACAAGATCCAT-CATTAGTACTCTTAT--T
Rabbit AGTTAA- CAG CCCCAATAGAAATAATCCAC-AAATTAATAATCTAT--T
Flying fox AGTTAA- CAa CAAAACAAATCCAACACCAC-AAGTAAAAGATTTAT---
Horse AGTTAA- CAA CAAGATAGGGATAATCCA--AAAACTAATCATCTAT---
Platypus AATTAA- CAG CTAAATAATCATAAATATT--AACTAGAAACATTAT---
Opossum AGTTAA- CAA AAACATAATAA-CATTCAT--CAACCAGCCTCTTAT---
Wallaby AATTAA- CAA ACTAATAATTTCAACCAA--ACAACTAGTAAAATTC--T
Cat AGTTAA- CAA CAAGATATATATAACCTA--ACCATAAACAAAATAT---
Deer CATTAA- CAG CAAAATAAGAATAACCTA--ATTATAAATAACTTAC---
Pig AATTAA- CAA CCAATAAACCAAAACAACAC----TAAAACGTTTAT---

Table 17

Structure loop 26' loop B' loop 27 loop 27' loop 24' loop 23' loop
rCRS position 2411 2419 2422 2423 2424 2427 2429 2435 2437 2438 2442 2447 2451
Human TACCCTCA CTG T C AAC CC AACACA GG C ATGC TCATA-- AGGA AA
Chimp TACCCCCG CTG T T AAC CC AACACA GG C ATGC CCACA-- AGGA AA
Gorilla TACCCCCA CTG T T AAC CC AACACA GG C ATGC CCACG-- AGGA AA
Orangutan TACCCCCA CTG T T AAT CC AACACA GG C ATGC CCATC-- AGGA AA
Cow TGATTATA CTG T T AAC CC AACACA GG A GTGC ATCTA-- AGGA AA
Elephant TATACCAA TTG T T AAC CC AACACA GG C ATGC TTAA--- GGGA AA
Sloth GTAACTCA CTG T T AAC CC AACACA GG A aTGC GTAC--- tGGA AA
Mouse TAACTTCT CTG T T AAC CC AACACC GG A ATGC CTAA--- AGGA AA
Capybara AGCTTTCC TTG T T AAC CC AACACA GG A GTGC ATTC--- AGGA AA
Rabbit AACTTTCA CTG T T AAC CC AACACA GG A GTGC TATAT-- AGGA AA
Flying fox TGAACCAA cTG T T AAC CC AACACA GG A GTGC ACTTA-A GGGA AA
Horse TTAAACCA TTG T T AAC CC AACACA GG C ATGC ATCTATA AGGA AA
Platypus TTTATAAA CTG T T AAC CC GACACA GG A GTGC ATCTA-- AGGA AA
Opossum ACAAAATT TTG T T AAT CC AACACA GG T GTGC ATTAA-- AGGA AA
Wallaby TACAACCA TTG T T AAC CC GACACA GG A GTGC TAAC--- AGGA AA
Cat CAAATTAA TTG T T AAC CC aacaca GG T ATGC AAATT-A GGGA AA
Deer TTATTATA CTG T T GAT CC aacaca GG A GTGC ACTTA-- AGGA AA
Pig TAATTACA TTG T T AAC CC aacaca GG A GTGC ACC---A AGGA AA

Table 18

Structure 28 loop 29 loop 30 loop C loop
rCRS position 2453 2472 2485 2493 2495 2500 2502 2503
Human GGTtaaaaAAAGTAAaAGG AACTCGGCAA----ATC ttACCCCG CC TGTTT AC C AA
Chimp GGTtaaaaAAAGTAAaAGG AACTCGGCAA----ATC ttACCCCG CC TGTTT AC C AA
Gorilla GGTtgaaaAAAGTAAaAGG AACTCGGCAA----ATT ttACCCCG CC TGTTT AC C AA
Orangutan GGTtaaaaAAAGTAAaAGG AACTCGGCAA----ATC tcACCCCG CC TGTTT AC C AA
Cow GATtaaaaGAAGTAAaAGG AACTCGGCAAACAC--- AAACCCCG CC TGTTT AC C AA
Elephant GATtaaaaGAaGGAAaAGG AACTCGGCAA--ACA-C AAACCCCG CC TGTTT AC C AA
Sloth GATtaaaaGAAGcAGaAGG AACTCGGCAA--ACA-T AAATCCCG CC TGTTT AC C AA
Mouse GATccaaaAAGATAAaAGG AACTCGGCAA--ACA-A GaACCCCG CC TGTTT AC C AA
Capybara GACaaaaaAAaGCAAaAGG AACTCGGCAAACAC--- AAATCCCG CC TGTTT AC C AA
Rabbit GATtaaaaGAAGAAAaAGG AACTCGGCAA--ACC-C TAACCCCG CC TGTTT AC C AA
Flying fox GATtaaaaGAAGTAAaAGG AACTCGGCAAACAC--- AAACCCCG CC TGTTT AC C AA
Horse GATtaaaaGAAGTAAaAGG AACTCGGCAA--ACA-C AAACCCCG CC TGTTT AC C AA
Platypus GATtaaaaGGAGTAAaAGG AACTCGGCAA--ACT-A GGATTTCG CC TGTTT AC C AA
Opossum GATataaaAGAAcAAaAGG AACTCGGCAA--ACA-T GAACCCCG CC TGTTT AC C AA
Wallaby GATtaaaaGGAATAAaAGG AACTCGGCAAATAC--- AAACCCCG CC TGTTT AC C AA
Cat GATtaaaaGAAGTAAaAGG AACTCGGCAAACAC--- AAGCCCCG CC TGTTT AC C AA
Deer GATtaaaaGAAGTAAaAGG AACTCGGCAAACACC-- AAACCCCG CC TGTTT AC C AA
Pig GATtaaaaGAAGTAAaAGG AACTCGGCAAACAC--- AAACCCCG CC TGTTT AC C AA

Table 19

Structure 30' loop 31 loop 31' loop 32 loop 33
rCRS position 2505 2510 2513 2521 2528 2538 2542 2545 2546
Human AAACA TCA CCTCTAGC ATCACCA GtaTTAGAGG CACC GCC T GCCcaGTGAC
Chimp AAACA TCA CCTCTAGC ATCACCA GtaTTAGAGG CACC GCC T GCCcgGTGAC
Gorilla AAACA TCA CCTCTAGC ATCACCA GtaTTAGAGG CACC GCC T GCCcaGTGAC
Orangutan AAACA TCA CCTCTAGC ATCACCA GtaTTAGAGG CACC GCC T GCCcgGTGAC
Cow AAACA TCA CCTCCAGC ATTCCCA GtaTTGGAGG CATT GCC T GCCcaGTGAC
Elephant AAACA TCA CCTCGAGC ATTACTA GtaTTCGAGG CACT GCC T GCCcaGTGAC
Sloth AAACA TCA CCTCTAGC ATAACAA CtaTTAGAGG CACC GCC T GCCcaGTGAC
Mouse AAACA TCA CCTCTAGC ATTACAA GtaTTAGAGG CACT GCC T GCCcaGTGAC
Capybara AAACA TCG CCTCTAGC ATAACTA GtaTTAGAGG CACT GCC T GCCcaGTGAC
Rabbit AAACA TCA CCTCTAGC ATTACTA GtaTTAGAGG CACT GCC T GCCcaGTGAC
Flying fox AAACA TCA CCTCTAGc ATAGCAA ctaTTAGAGG CACT GCC T GCCcaGTGAC
Horse AAACA TCA CCTCTAGC ATTTCCA GtaTTAGAGG CACT GCC T GCCcaGTGAc
Platypus AAACA TCG CCTCTAGC ATAACAA GtaTTAGAGG TCCT GCC T GCCcaGTGAT
Opossum AAACA TCA CCTCTAGC ATTACAA GtaTTAGAGG CACT GCC T GCCcaGTGAA
Wallaby AAACA TCA CCTCTAGC ATAACAA AtaTTAGAGG CAAC GCC T GCCcaGTGAG
Cat AAACA TCA CCTCTAGC ATTTCCA GtaTGAGAGG CACT GCC T GCCcgGTGAC
Deer AAACA TCA CCTCCAGC ATAACTA GtaTTGGGGG CATT GCC T GCCcaGTGAC
Pig AAACA TCA CCTCTAGC ATTACTA GtaTTAGAGG CAAT GCC T GCCcaGTGAc

Table 20

Structure loop 33' 34 loop 34' loop 35 loop
rCRS position 2556 2560 2570 2576 2582 2588 2590 2593
Human AC--A-T GTTtaACGGC CGCGGT ACCCTA ACCGTG CA AAG GTAGCATAA
Chimp AT--A-T GTTtaACGGC CGCGGT ACCCTA ACCGTG CA AAG GTAGCATAA
Gorilla AT--G-C GTTcaACGGC CGCGGT ACCCTA ACCGTG CA AAG GTAGCATAA
Orangutan AT--G-T GTTtaACGGC CGCGGT ACCCTG ACCGTG CA AAG GTAGCATAA
Cow AA---CT GTTtaACGGC CGCGGT ATCCTG ACCGTG CA AAG GTAGCATAA
Elephant CA-AG-C GTTaaACGGC CGCGGT ACTCTG ACCGTG CA AAG GTAGCATAA
Sloth A--TA-C GTTcaACGGC CGCGGT ACCCTG ACCGTG CA AAG GTAGCATAA
Mouse T--AA-A GTTtaACGGC CGCGGT ATCCTG ACCGTG CA AAG GTAGCATAA
Capybara AACCC-A GTTcaACGGC CGCGGT ATCCTG ACCGTG CA AAG GTAGCATAA
Rabbit G--TA-C GTTcaACGGC CGCGGT ATCCTG ACCGTG CA AAG GTAGCATAA
Flying fox A--TC-T GTTaaACGGC CGCGGT ATCCTG ACCGTG CA AAG GTAGCATAA
Horse A--TCTG tTTaaACGGC CGCGGT ATCCTA ACCGTG CA AAG GTAGCATAA
Platypus T----CT ATTaaACGGC CGCGGT ATCCTG ACCGTG CA AAG GTAGCATAA
Opossum T--AAAC TTTtaACGGC CGCGGT ATCCTG ACCGTG CA AAG GTAGCATAA
Wallaby TT-TATA CTTcaACGGC CGCGGT ATTCTG ACCGTG CA AAG GTAGCATAA
Cat GC---TA GTTaaACGGC CGCGGT ACCCTG ACCGTG CA AAG GTAGCATAA
Deer AA---CC GTTtaACG-C CGCGGT ATCCTG ACCGTG CA AAG GTAGCATAA
Pig ACCAG-- tTTaaCGG-C CGCGGT ATTCTG ACCGTG CA AAG GTAGCATAA

Table 21

Structure loop 35' 36 loop 36' loop 32' loop 29'
rCRS position 2602 2605 2608 2614 2619 2625 2635 2638 2642
Human TCA CTT GTTCCT TAAAT AGGGAC CTGTATGAAT GGC TCCA CGaGGGTtc
Chimp TCA CTT GTTCCT TAAAT AGGGAC TTGTATGAAT GGC TCCA CGaGGGTtt
Gorilla TCA CTT GTTCCT TAAAT AGGGAC TCGTATGAAT GGC TCCA CGaGGGTtc
Orangutan TCA CTT GTTCCT TAAAT GAGGAC TTGTATGAAT GGC TCCA CGaGGGTtc
Cow TCA TTT GTTCTC TAAAT AAGGAC TTGTATGAAT GGC CGCA CGaGGGTTT
Elephant TCA TTT GTTCCT TAATT AGGGAC TTGTATGAAC GGC CACA CGaGGGTTT
Sloth TCA TTT GTTCTT TAATT AAGGAC TTGCATGAAA GGC CCAA CGaGGATTT
Mouse TCA CTT GTTCCT TAATT AGGGAC TAGCATGAAC GGC TAAA CGaGGGTcC
Capybara TCA CTT GTTCTT TAAAT AAGGAC TAGTATGAAC GGC TTAA CGaGGATTT
Rabbit TCA CTT GTTCCT TAATT GGGGAC TAGCATGAAT GGC AACA CGaGGGTTA
Flying fox TCA TTT GTTCTC TAAAT AAGGAC TTGTATGAAT GGC CACA CGaGGGTTT
Horse TCA CTT GTTCCC TAAAT AGGGAC TTGTATGAAT GGC CACA CGaGGGTTT
Platypus TCA TTT GTCTCC TAATT AGAGAC TAGTATGAAT GGC TAGA CGaAAATCC
Opossum TCA CTT GTCTCC TAAAT AGGGAC TTGTATGAAT GGC ATAA CGaGGGTTC
Wallaby TCA CTT GTCTCT TAATT AGAGAC TTGTATGAAT GGC ACCA CGaGGGTTT
Cat TCA TTT GTTCCC TAAAT AGGGAC TTGTATGAAC GGC CACA CGaGGGCTT
Deer TCA TTT GTTCTC TAAAT AAGGAC TTGTATGAAT GGC CAAA CGaGGGTTT
Pig TCA CTT GTTCTC CAAAT AAGGAC TTGTATGAAT GGC CACA CGaGGGTTT

Table 22

Structure loop 28' loop 22' loop C' loop 37 loop 37'
rCRS position 2651 2656 2672 2673 2675 2680 2681 2686 2691 2699
Human AGCTG TCTcTTACTTTtaACC A GT GAAAT T GACCT GCCCG TGAAGAGG CGGGC
Chimp AGCTG TCTcTTACTTTcaACC A GT GAAAT T GACCT ACCCG TGAAGAGG CGGGC
Gorilla AGCTG TCTcTTACTTTtgACC A GT GAAAT T GACCT GCCCG TGAAGAGG CGGAC
Orangutan GACTG TCTcTTACTTTtaACC A GT GAAAT T GACCT GCCCG TGAAGAGG CGGGC
Cow TACTG TCTcTTACTTCcaATC A GT GAAAT T GACCT TCCCG TGAAGAGG CGGGA
Elephant AACTG TCTcTTTCcTCtaATC A AT GAAAT T GACCT TCTCG TGAAGAGG CGAGA
Sloth TACTG TCTcCTaCTTCcaATC A AT GAAAT T GACCC CCCcG TGAAGAGG CaGGG
Mouse AACTG TCTcTTATCTTtaATC A GT GAAAT T GACCT TTCAG TGAAGAGG CTGAA
Capybara AACTG TCTcTTGCcTTatGTC T GT GAAAT T GACCT CCCCG TGAAGAGG CGGGG
Rabbit AACTG TCTcTTTCTTCcaATC A GT GAAAT T GACCT CCCCG TGAAGAGG CGGGG
Flying fox TACTG TCTcTTACTTCcaATC A GT GAAAT T GACCC TCCCG TGAAGAGG CGGGA
Horse TACTG TCTcTTACTTCcaATC A GT GAAAT T GACCT TCCCG TGAAGAGG CGGGA
Platypus AACTG TCTcTTACTCCcaATC A GT GAAAT T GCCCT CCCCG TGCAGAGA CGGGG
Opossum AACTG TCTcTTtTTCTtaATC A AT GAAAT T GACCT ACCCG TGCAGAGG CGGGT
Wallaby AACTG TCTcTTATTCCcaATC A GT GAAAT T GACCT TCCCG TGCAGAGG CGGGA
Cat TACTG TCTcTTACTTCcaATC C GT GAAAT T GACCT TCCCG TGAAGAGG CGGGA
Deer TACTG TCTcTTACTTCcaATC A GT GAAAT T GACCT TCCCG TGAAGAGG CGGGA
Pig TACTG TCTcTTACTTCcaATC A GT GAAAT T AACCT TCCCG TGAAGAGG CGGGA

Table 23

Structure loop 38 loop 39 loop 40
rCRS position 2704 2711 2721 2726 2739 2740
Human ATAACAC AGCaAGAcGA GAAGA CCCTAtGGAGCTT T AATTtaTTAATGCA
Chimp ATAACAT AACaAGAcGA GAAGA CCCTAtGGAGCTT T AATTcaTTAATGCA
Gorilla ATAACAT AACaAGAcGA GAAGA CCCTAtGGAGCTT T AATTcaTTAATGCA
Orangutan ATAACAT AACaAGAcGA GAAGA CCCTAtGGAGCTT C AATCtaCCAGTGCA
Cow ATGCACA AATaAGAcGA GAAGA CCCTAtGGAGCTT T AACTaaCCAACCCA
Elephant ATAAACA TATaAGAcGA GAAGA CCCTAtGGAGCTT A AATTaaCTAATTTA
Sloth ATAACCA TATaAGAcGA GAAGA CCCTAcGGAACTT T AATTaaCTAGCCTA
Mouse ATATAAT AATaAGAcGA GAAGA CCCTAtGGAGCTT A AATTatATAACTTA
Capybara ATAACTT AACaAGAcGA GAAGA CCCTAtGGAGCTT T AATTtaTTAATTTA
Rabbit ATAAAAT AATaAGAcGA GAAGA CCCTAtGGAGCTT T AATTatTTAACCCA
Flying fox ATATACA AATaAGAcGA GAAGA CCCTAtGGAGCTT T AATTaaTTAGCCCA
Horse ATGACTA AATaAGAcGA GAAGA CCCTAtGGAGCTT T AATTaaCTGATTCA
Platypus ATAACAC CATaAGAcGA GAAGA CCCTGtGGAGCTT T AATC--ATAGATTT
Opossum ATATTAA TATaAGAcGA GAAGA CCCTGtGGAGCTT A AGATTaATAACTTA
Wallaby ATATACA TACaAGAcGA GAAGA CCCTGtGGAGCTT A AGATTcATAGTCTA
Cat ATATAAT AATaAGAcGA GAAGA CCCTAtGGAGCTT T AATTaaCCGACCCA
Deer ATACTAT AATaAGAcGA GAAGA CCCTAtGGAGCTT T AACTacTTAGTCCA
Pig ATAAAAA AATaAGAcGA GAAGA CCCTAtGGAGCTT T AATTaaCTATTCCA

Table 24

Structure loop
rCRS position 2754
Human AACAGTA-CCTAACAAACCCACA-------GGTCCTAAACTACCA--AAC--C
Chimp AACAATA-CTTAACAAACCTACA-------GGTCCTAAACTATTA--AAC--C
Gorilla AGCAACA-CTTAATAAACCCACA-------GGTCCTAAACTACCA--AAC--C
Orangutan AATAACA-TATAACAAGCCCACA-------GGTCCTAATTCACCA--AAC--C
Cow -AAGAGAATAGATTTAACCATTAA------GGAATAACAACAATC--TCC--A
Elephant ATTGCTAGCCTA-TAAATCTATAA------GATACAACTAAACAG-CATG--A
Sloth ---TCATAACCCATACAAACCTAGC----GGGGACAACTTTCCA----TGACC
Mouse TCTATTTAATTTATTAAACCTAAT------GGCCCAAAAACTATAGTA-----
Capybara -ACTTAACCACTTTAAACCCACAAG-----GGCACAAATACACAC---AAGCC
Rabbit -ACACTTCCTTTATTCTACTCTACA--ATGAGCCTAACCAAGGAA--ATC-CC
Flying fox ATAAATAAATAACTTACACTTCTA-----AGGAA-AACAAGAAACCTTTTGA-
Horse CAAAAAACAACACACAAACCTTAACCTTCAGGGACAACAAAACT--TTTG-AT
Platypus ATTCTTTTTCATACAGACCCAAAA-------GCTCAACACCTTAAGAATT---
Opossum AATAAAACTAGT-ACAAACCCTAG------GGAATAACATTATT---ATT-AT
Wallaby ---ATTCAAATCATCCTACCCTACA-TGCRGGAACAAACCAAGACCTA----C
Cat -AAGAGACCATATGAACCAACCGACA----GGAACAACAAACCTCTATA----
Deer -AAGAATAAATTCACTAACCAAG-------GAAACAACAATATTC--TTC--A
Pig AAAGTTAAACAACTCAACCACAAAGG----GATAAAACATAACTTAACA----

Table 25

Structure 40' loop 41 loop 41' 42 loop
rCRS position 2795 2808 2810 2815 2818 2823 2829
Human TGCATTAAaAATT TC GGTTG GGG CGACC TCGGAG CAGAACCCAAC
Chimp TGCATTAAaAATT TC GGTTG GGG CGACC TCGGAG CACAACCCAAC
Gorilla TGCATTAAaAATT TC GGTTG GGG CGACC TCGGAG TATAATCTAAC
Orangutan TGCACTGAaGATT TC GGTTG GGG CGACC TCGGAG TATAACCCAAC
Cow TGAGTTGGtAGTT TC GGTTG GGG TGACC TCGGAG AATAAAAAATC
Elephant TAAATTAAcAATT TT GGTTG GGG TGACC TCGGAG AAGAAAAAATC
Sloth TAGACTAGcAATT TC GGTTG GGG TGACC TCGGAG TACAAAAAAAC
Mouse TAAGTTTGaAATT TC GGTTG GGG TGACC TCGGAG AATAAAAAATC
Capybara TAAATTAAtAATT TC GGTTG GGG TGACC TCGGAG AATAATAAAAC
Rabbit TGGGTTAAaAATT TT GGTTG GGG TGACC TCGGAG TATAAATCAAC
Flying fox TGGGCTAAcAATT TA GGTTG GGG TGACC TCGGAA TACAAAACAAC
Horse TGAATCAGcAATT TC GGTTG GGG TGACC TCGGAG AACAAAACAAC
Platypus TTTTCAACtGATT TT GGTTG GGG TGACC TCGGAG TACAACAAAAC
Opossum TAAGTTATATTCT TT GGTTG GGG TGACC TCGGAG AACAAAAAAAC
Wallaby TAGACTATAACCT TT GGTTG GGG TGACC TCGGAG CATAAAAGACC
Cat TGGGCCGGcAATT TA GGTTG GGG TGACC TCGGAG AATAAAACAAC
Deer TGGACTAAcAGCT TT GGTTG GGG TGACC TCGGAG AACAGAAAATC
Pig TGGACTAGcAATT TC GGTTG GGG TGACC TCGGAG TACAAAAAACC

Table 26

Structure 42' loop 44 loop D loop 44' loop
rCRS position 2840 2846 2855 2863 2867 2868 2870 2878
Human CTCCGA GCAGT--ACAT GCtaaGAC TTCA C CA GTCaaaGC GAA-CTACT
Chimp CTCCGA GCAAT--ACAT GCtaaGAC CTCA C CA GTCaaaGC GAA-TTACT
Gorilla CTCCGA ACAAC--ACAT GCcaaGAC TTCA C CA GTCaaaGC GAG-CTACC
Orangutan CTCCGA GAAAC--ACAT GTtaaGAC TTCA C AA GTCaaaAC AAA-CTTCC
Cow CTCCGA GCGATTTTAAA GActaGAC C-CA C AA GTCaaaTC ---ACTCTA
Elephant CTCCGA ACGATATTATA ATttaGAC TCTA C AA GTCaaaAT ---TTACTA
Sloth CTCCGA ATGACC-ATGC ACccaGAC CTCA C CA GTCaacGT GCCTCAATA
Mouse CTCCGA ATGAT--TATA ACctaGAC T-TA C AA GTCaaaGT ---AAAATC
Capybara CTCCGA ATGAT--ATTA ACctaGAC ACTA C AA GTCaaaGT ---CCACAA
Rabbit CTCCGA ATGAT--TTTA GCctaGAC CCAA C AA GTCaaaGC A-ATTATAA
Flying fox TTCCGA GAGAC--AAAA aCttaGAC C-AA C AA GTCaacGg ---ATTCAG
Horse CTCCGA GTGAT--TTAA ATccaGAC T-AA C CA GTCaaaAT ---ATATAA
Platypus CTCTGA ATGCA----TA GTaatAAC T-TA C AA GTTtaaAC ---GCAAAA
Opossum CTCCGA ATGAC---ATA ACctaGAT T-AA C TA ATCcaaGT ---GCACAA
Wallaby CTCCGA ATGAT---TAA GCctaGAT T-CA T TG ATCtaaGC ---GTAACA
Cat CTCCGA GTGAT--TTAA aTctaGAC T-AA C CA GTCgaaAg --TACTACA
Deer CTCCGA GCGATTTTAAA GActaGAC T-CA C AA GTCaaaTC ---ACACAA
Pig CTCCGA GTGAT--TTTA ATctaGAC A-AA C CA GTCaaaAT --AACCATA

Table 27

Structure loop 45 loop 45' loop D' loop 39'
rCRS position 2886 2900 2903 2907 2910 2916 2917 2921
Human ATACTC---AATTGATC CAA T---AAC TTG ACCAAC G GAAC AAGTTacCCTAGGG
Chimp ACATCC---AATTGATC CAA T---GAC TTG ACCAAC G GAAC AAGTTacCCTAGGG
Gorilla ACATTT---AATTGATC CAA T---GAC TTG ACCAAC G GAAC AAGTTacCCTAGGG
Orangutan ACACAC---AATTGATC CAA T---AAC TTG ACCAAC G GAAC AAGTTacCCTAGGG
Cow TCGC----TCATTGATC CAA A---AAC TTG ATCAAC G GAAC AAGTTacCCTAGGG
Elephant ATCGC---TTATTGACC CAA ----TAC TTG ATCAAC G GAAC AAGTTacCCTAGGG
Sloth TCAAC--TCAATTGACC CAA G---TAA TTG ATCAAC G GAAC AAGCTacCCTAGGG
Mouse AACATATCTTATTGACC CAG ATATATT TTG ATCAAC G GACC AAGTTacCCTAGGG
Capybara TCATC----AATTGACC CAA AAACCTT TTG ATCAAC G GACC AAGTTacCCTAGGG
Rabbit TCATA----AATTGACC CAA A--TAAT TTG ATCAAC G GAAC AAGTTacCCTAGGG
Flying fox TCAT----TTATTGATC CAA A---AAA TTG ATCAAC G GAAC AAGTTacCCTAGGG
Horse TCAC----TTATTGATC CAA --A-CCA TTG ATCAAC G GAAC AAGTTacCCTAGGG
Platypus CTGCC-AGTAATAGACC CAA A---TTA TTG ATCAAA G GACC AAGTTacCCCAGGG
Opossum -AAGCCAGTAATTGACC CAA ----ATA TTG ATCAAC G GAAC AAGTTacCCCAGGG
Wallaby CTACC-AGTAATTGACC CAt ----ACT tTG ATCAAC A GAAC AAGTTacCCCAGGG
Cat TCAC----TTATTGATC CAA AAACC-- TTG ATCAAC G GAAC AAGTTacCCTAGGG
Deer TCGC----TTATTGATC CAA A---AAA TTG ATCAAC G GAAC AAGTTacCCTAGGG
Pig ACATC-ACTTATTGATC CAA A---ATT TTG ATCAAC G GAAC AAGTTacCCTAGGG

Table 28

Structure loop 46 loop 46'
rCRS position 2935 2942 2959 2966
Human ATAACAG CGcAATCCTATTctaGA GTCCATA TCaacAAT--AGGGTTtaCG
Chimp ATAACAG CGcAATCCTATTccaGA GTCCATA TCaacAAT--AGGGTTtaCG
Gorilla ATAACAG CGcAATCCTATTctaGA GTCCATA TCaacAGT--AGGGTTtaCG
Orangutan ATAACAG CGcAATCCTGTTctaGA GTCCATA TCaacGAC--AGGGTTtaCG
Cow ATAACAG CGcAATCCTATTcaaGA GTCCATA TCgacAAT--AGGGTTtaCG
Elephant ATAACAG CGcAATCCTaCTctaGA GTCCCTA TCgacAGc--AGGGTTtaCG
Sloth ATAACAG CGcAATCCTATTtcaGA GTCCATA TCgacAAT--AGGGTTtaCG
Mouse ATAACAG CGcAATCCTATTtaaGA GTTCATA TCgacAATt-AGGGTTtaCG
Capybara ATAACAG CGcAATCCTGTTttaGA GTCCATA TCgacAAC--AGGGTTtaCG
Rabbit ATAACAG CGcAATCCTATTttaGA GTCCCTA TCgacAAT--AGGGTTtaCG
Flying fox ATAACAG CGcAATCCTATTtgaGA GTCCATA TCgatAAT--AGGGTTtaCG
Horse ATAACAG CGcAATCCTATTccaGA GTCCATA TCgacAATt-AGGGTTtaCG
Platypus ATAACAG CGcAATCCTATTcaaGA GTTCATA TCgacAAT--AGGGTTtaCG
Opossum ATAACAG CGcAATCCTATTtaaGA GCCCATA TCgaaAATctAGGGTTtaCG
Wallaby ATAACAG CGcAATCCTATTtaaGA GCCCATA TCgacAATt-AGGGTTtaCG
Cat ATAACAG CGcAATCCTATTtcaGA GTCCATA TCgacAAT--AGGGTTtaCG
Deer ATAACAG CGcAATCCTATTcaaGA GTCCATA TCgacAAT--AGGGTTtaCG
Pig ATAACAG CGcAATCCTGTTctaGA GTTCCTA TCgacAAT--AGGGTTtaCG

Table 29

Structure loop 47 loop 48 loop 48' loop
rCRS position 2984 2994 3005 3007 3017 3021 3033
Human ACCTCGATGT TGGATCAGGAC AT CCcGATGGTG CAGC CGCTATTaaaGG T
Chimp ACCTCGATGT TGGATCAGGAC AT CCcGATGGTG CAGC CGCTATTaaaGG T
Gorilla ACCTCGATGT TGGATCAGGAC AT CCcGATGGTG CAGC CGCTATCaaaGG T
Orangutan ACCTCGATGT TGGATCAGGAC AT CCcAATGGTG CAGC CGCTATTaaaGG T
Cow ACCTCGATGT TGGATCAGGAC AT CCtGATGGTG CAAC CGCTATCaaaGG T
Elephant ACCTCGATGT TGGATCAGGAC AT CCtAATGGTG CAGC CGCTATTaagGG T
Sloth ACCTCGATGT TGGATCAGGAC AT CCcAGTaGTG TAAC CGCcACTaaaGG T
Mouse ACCTCGATGT TGGATCAGGAC AT CCcAATGGTg TAGA aGCTATTaatGG T
Capybara ACCTCGATGT TGGATCAGGAC AT CCtAATGGTG CAGC CGCTATTaagGG T
Rabbit ACCTCGATGT TGGATCAGGAC AT CCcAATGGTG TAGC CGCTATTaaaGG T
Flying fox ACCTCGATGT TGGATCAGGAC AT CCcAATGGTG CAGC CGCTATTaatGG T
Horse ACCTCGATGT TGGATCAAGAC AT CCtAATGGTG CAAC CGCTATTaagGG T
Platypus ACCTCGATGT TGGATCAGGAC AT CCaAATGGTG CAGC CGCTATTaatGG T
Opossum ACCTCGATGT TGGATCAGGAC AT CCtAATGGTG CAAC CGCTATTaaaGG T
Wallaby ACCTCGATGT TGGATCAGGAC AT CCaAATGGTG CAGC CGCTATTattGG T
Cat ACCTCGATGT TGGATCAGGAC AT CCcGATGGTg CAGC aGCTATCaaaGG T
Deer ACCTCGATGT TGGATCAGGAC AC CCcGATGGTG CAAC CGCTATCaaaGG T
Pig ACCTCGATGT TGGATCAGGAC AC CCaAATGGTG CAGC CGCTATTaaaGG T

Table 30

Structure 49 loop 49' loop 47' loop C' loop 50
rCRS position 3034 3039 3044 3049 3054 3070 3073 3074 3075
Human TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Chimp TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Gorilla TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Orangutan TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Cow TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Elephant TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Sloth TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Mouse TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Capybara TCGTT TGTTC AACGA TTAACA GTCCTacGtgATCTgA GTT C A GACCGGA
Rabbit TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Flying fox TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Horse TCGTT TGTTC AACGA TTAA-A GTCTTacGtgATCTgA GTT C A GACCGGA
Platypus TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Opossum TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Wallaby TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Cat TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Deer TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA
Pig TCGTT TGTTC AACGA TTAA-A GTCCTacGtgATCTgA GTT C A GACCGGA

Table 31

Note: The Revised CRS (rCRS) deletes the 'C' at the original CRS position 3107 but retains the original numbering. The secondary structure model given by Burk, Douzery and Springer (2002) is based on the original CRS and includes the 'C' at 3107 as the last base in the 38' stem, followed by the 'T' at 3108 as the first base in the following loop. The 'A' at position 2711 in Table 23 causes a base pairing of A-C at this spot within the 38 stem.

In Table 31 I have omitted the 'C' at 3107 per the rCRS; position 3106 is followed by 3108, with the loop starting at 3109. This results in a canonical base pairing of A-T. Note that all of the other species in Table 31 have a canonical base pairing at this position as well (A-T or C-G).

Structure loop 50' loop 38' loop 51 loop
rCRS position 3082 3086 3094 3098 3109 3113 3127
Human GTAA TCCaGGTC GGTT TCtaTCTACT -TCAA ATTCCTCcctgTAC G-AAA
Chimp GTAA TCCaGGTC GGTT TCtaTCTGTT -CTAA ATTTCTCcctgTAC G-AAA
Gorilla GTAA TCCaGGTC GGTT TCtaTCTATT -CCGT GTTTCTCcctgTAC G-AAA
Orangutan GCAA TCCaGGTC GGTT TCtaTCTATT -TCAC ATTTCTCcctgTAC G-AAA
Cow GTAA TCCaGGTC GGTT TCtaTCTATT -ACGT ATTTCTCccagTAC G-AAA
Elephant GCAA TCCaGGTC GGTT TCtaTCTATA -GTTT ATTTaTTccagTAC G-AAA
Sloth GTAA TCCaGGTC GGTT TCtaTCTATA -AACC tTTTCTCccagTAC G-AAA
Mouse GCAA TCCaGGTC GGTT TCtaTCTATT TACG- ATTTCTCccagTAC G-AAA
Capybara GTAA TCCaGGTC GGTT TCtaTCTGTT -TAAG ACTTCTCccagTAC G-AAA
Rabbit GAAA TCCaGGTC GGTT TCtaTCTATT -AAGT ATTTCTCccagTAC G-AAA
Flying fox GTAA TCCaGGTC GGTT TCtaTCTATT -TTGT GcTTCTCccagTAC G-AAA
Horse GTAA TCCaGGTC GGTT TCtaTCTATT -CTAT ACTTTTCccagTAC G-AAA
Platypus GTAA TCCaGGTC GGTT TCtaTCTATG -GGTA ATTTCTCctagTAC GGAAA
Opossum GAAA TCCaGGTC GGTT TCtaTCTATA TATTA ATTTCTCccagTAC G-AAA
Wallaby GAAA TCCaGGTC GGTT TCtaTCTGTA CATTA ATTcCTCccagTAC G-AAA
Cat GTAA TCCaGGTC GGTT TCtaTCTATT TAATA ACTTCTCccagTAC G-AAA
Deer GTAA TCCaGGTC GGTT TCtaTCTATT -ACGT ATTTCTCtcagTAC G-AAA
Pig GCAA TCCaGGTC GGTT TCtaTCTATT -ATAA ATTTCTCccagTAC G-AAA

Table 32

Structure 51' 52 loop 52' loop 53
rCRS position 3131 3144 3155 3159 3168 3174
Human GGAcaaGAGAAAT AAGGCctaCTT CACA-- AAGcGCCTT CCCCCG--- TAAaTGA
Chimp GGAcaaGAGAAAT GAGGCctaCTT CACA-- AAGcGCCTT CCCCAA--- TAAaTGA
Gorilla GGAcaaGAGAAAC GAGGCctaCTT CACA-- AAGcGCCTC CCCCCG--- TAAaTGA
Orangutan GAAcaaGAGAAAT GGGGCctaCTT CACA-- AAGcGCCTT TCCC-A-AA cAAaTGA
Cow GGAcaaGAGAAAT AAGGCcaaCTT TAAATC AAGcGCCTT AAGAC--AA cCAaTGA
Elephant GGAcagAAaAAAT GAGGCcaaTCT TACCA- AGAcGCCTC CAGCTA-AA TttATGA
Sloth GGAcaaGAGAAAc tGGGCctaCTc TACAA- aAGcGCCCt AAAACCTAA TAGATgA
Mouse GGAcaaGAGAAAT AGAGCcacCTT ACAAAT AAGcGCTCT CAACTT-AA TTTATgA
Capybara GGAcaaGAGAAGT GGGGCcaaTGG -TCAAG CCAtGCCCT GATAACTAA AaAATGA
Rabbit GGAcaaGAGAAAT AGAGCctaCTG CACCA- CAGaGCTCT AAGTCC-AA aAGATGA
Flying fox GGAcaaGAGAGaC AGGGCctaCTT -AACAC AAGcGCCCT TAAAGCCAA CAGATGA
Horse GGAcaaGAAAAGT AGGGCccaCTT TACAAG AAGcGCCCT CAAACT-AA TAGATgA
Platypus GGAccaGAGAAAT cAGGCcaaTCT TAAAA- AGAaGCCTc CAACTT-AA CAAATGA
Opossum GGAccaGAGAAAT AGGGCcaaCAT TATCT- ATGcGCCCT CATAA--AA TTAATgA
Wallaby GGAcaaGAGaAAT AGGGCctaCGC TATATA GTGaGCCTT AGAAAT-AA GATATgA
Cat GGAcaaGAGAAGT GAGGCccaCTT CACCA- AAGcGCCTT TAACCA-AA TAGATgA
Deer GGAccaGAGAAAT AGGGCcaaCTT AGAAC- AAGcGCCTT AAATT--AA cTAATgA
Pig GGAcaaGAGAAAT GGGaCcaaCcT CACA-- AacGcGTCT CAGAGATAA TTAaTgA

Table 33

Structure loop 53' loop 54 loop 54' loop
rCRS position 3181 3188 3196 3213 3217 3224 3228
Human TATC-ATC TCAacTTA GTA---TTATACCCACACCC ACCC AAGAACA GGGT TT--
Chimp TATT-ATC TCAatTTA ACG---CCATGCCAACACCC ACTC AAGAACA GAGT T---
Gorilla TACT-ATC TCAatTTA ATA---TAGCGCCCACATCT ACTG AAGAATA GGGT TT--
Orangutan TATC-ATC TCAatTTa ACA---CTACACCAACACCC ACCC AAGAAAA GGGT TT--
Cow TAAC-ATC TCAacTGa C------AACACAAAACCCT GCCC TAGAACA GGGC TTA-
Elephant ATAA-ATC TCAaTctA GATAAGCTAAACCACCCA-- ATCC AAGAACA GGAT TT--
Sloth CCAA-ATC TaAaTCTA GTAAA-TCATCTAACAACCA ACCC AAAACCA GGGT TT--
Mouse ATAA-ATC TaAaTAAA ATATATACGTACACCCTCT- AACC TAGAGAA GGTT ----
Capybara TATC-ATA TTAaTTcT ATCA--TTATCCTAAATTCA CCCC TAAAACA GGGG TT--
Rabbit AATA-ATC TTAaTCTa GTACACTTACCCAACATAGA GCcC TAGACCA GaGC TA--
Flying fox CACA-ATC TCAaTCTG ATAGCAACAGCACAACTCA- ACCC GAAAACA GGGT TA--
Horse CATA-ATC TaAaTCTA ACTAATTTATAACTTCTACC GCCC TAGAACA GGGC TC--
Platypus TTTC-ATC TCAaTTTG CCA---CGTTACCCTTACTA aTCC TAGACCA GGAa TTCT
Opossum AATATATC TaAaTTAA ACCATTTAA--ACTTTATCC aCTC TAGATAA GAGc CC--
Wallaby ATTA-ATC TaAaTATC CTAATTCAA--TCACTTCCC ACTC TAGAAAA GAGT TA--
Cat TATAATCT TaATCTAg ACAGTTTATCCAAACACACT aCCc gagagct cGGg TTT-
Deer TTTACTCT TaATTaGa T----ACACAAACAAATCTC GCCC TAGAAAA GGGC TTT-
Pig TTTACTCT TaAccTAA TTAACTCATAA-TAAATCCA GCCC TAGAACA GGGC ACA-

 

Copyright © 2008, Gary L. Hines, All Rights Reserved / Last updated 20 Jan 2008